anxa3a

Ensembl ID:
ENSDARG00000009196
ZFIN ID:
ZDB-GENE-040912-58
Description:
annexin A3a [Source:RefSeq peptide;Acc:NP_001004632]
Human Orthologue:
ANXA3
Human Description:
annexin A3 [Source:HGNC Symbol;Acc:541]
Mouse Orthologue:
Anxa3
Mouse Description:
annexin A3 Gene [Source:MGI Symbol;Acc:MGI:1201378]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33665 Nonsense Available for shipment Available now
sa40518 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004286 Nonsense 78 340 5 14
Genomic Location (Zv9):
Chromosome 5 (position 40689799)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38489189
GRCz11 5 39089342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGACCCACAGAAGCAGCAGTCAGAAGCAGGAGATTGCTAAAGCATAC[C/T]GAGAAACCACAAAGAGGGTGAATCTGTGTTCTTTTGCTCAAAGCCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004286 Essential Splice Site 121 340 6 14
Genomic Location (Zv9):
Chromosome 5 (position 40690014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38489404
GRCz11 5 39089557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCTCTGGCTGTCAATGATGCTGAATGGTTGCACGAAGCACTGAAAG[T/G]CAGTAGCTGTTTCTTAAGTTTTTGTGTATATTGAACAATTACTATTTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link