si:dkey-27a13.3
- Ensembl ID:
- ENSDARG00000009194
- ZFIN IDs:
- ZDB-GENE-041111-169, ZDB-GENE-041111-169, ZDB-GENE-060503-446
- Description:
- Novel protein similar to mouse procollagen, type XVI, alpha 1 (Col16a1) [Source:UniProtKB/TrEMBL;Acc
- Human Orthologue:
- COL16A1
- Human Description:
- collagen, type XVI, alpha 1 [Source:HGNC Symbol;Acc:2193]
- Mouse Orthologue:
- Col16a1
- Mouse Description:
- collagen, type XVI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095396]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa16684 |
Nonsense |
Available for shipment |
Available now |
sa8492 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa15494 |
Nonsense |
Available for shipment |
Available now |
sa10058 |
Essential Splice Site |
Available for shipment |
Available now |
sa12058 |
Nonsense |
Available for shipment |
Available now |
sa29247 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa36890 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa10956 |
Nonsense |
Available for shipment |
Available now |
sa43329 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa16684
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 40142994)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
39006977 |
GRCz11 |
19 |
38594097 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGCACGTGGACTGCAGCTCCATTGAGAACAARCCTCTGGAGCTCCGCGGC[C/T]AGTTGCCYATCAGTGGACACACRCTGTTGGGGATGAGGGCTACTGATGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8492
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 40084696)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38948679 |
GRCz11 |
19 |
38535799 |
- KASP Assay ID:
- 2261-3594.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCAAAAGGGAGAGAAGGGAGATCCTGGTGTTGGGCAGAAAGGAGAGCAGG[T/C]GAATGTGATGGACTGATTTCTCATTGACATCCAGCACACATCATTAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15494
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 40075337)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38939320 |
GRCz11 |
19 |
38526440 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTTTTCTCTGCATTAAATATCATATCTATGTCTGTAGGGTGATCAGGRTT[T/G]ACAAGGAGACTCAGGTACACCTGGTACACCTGGAGTCGCAGGACCTCAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10058
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 40074900)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38938883 |
GRCz11 |
19 |
38526003 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGARAGAGGAGAGCCGGGTTTGCCAGGCGAGGGCCGAGAAGGRAAACAG[G/T]TGCACAKTTTTTGCTGTCTTTCTMAATTAATTWGTAGTTTTGTTSTGAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12058
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 40044978)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38908961 |
GRCz11 |
19 |
38496081 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTCAGCAAGGTCAAAGAGGGACAGATGGGAATCCAGGACTGAAGGGCGAA[C/T]AGGTRAGTTAACTGTACTTATGGGTGAAAWATGCTAATTTTGCAGTACCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29247
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 40044840)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38908823 |
GRCz11 |
19 |
38495943 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAGGAAGTCCTGGCTATCCTGGAACTATGGGACCACCCGGTCTCCCTG[T/C]GAGTAGTTACATCCTGTTGCCATATTGTTCACTAATTGTGCTTTTATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36890
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 40037560)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38901543 |
GRCz11 |
19 |
38488663 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAGGGTGTTGCTGGAGTTGCAGGCCCACAGGGGCCCACAGGTCCTCCA[G/T]GATCACCAGGGTCCCCAGGCATGCCTGTGAGTGCTAATAGGTTTTCAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10956
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 19 (position 40037369)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38901352 |
GRCz11 |
19 |
38488472 |
- KASP Assay ID:
- 2261-3589.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGGACCACCTGGAATGGAAGGACTTGATGGCAAAGATGGAAAACCAGGTT[T/A]AAGGGTCAGAAAAAMACTCTCATACAGTCTCCCATAGTTTTTNCTGGAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43329
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 19 (position 40024578)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
19 |
38888561 |
GRCz11 |
19 |
38475681 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTGGGCAGATTGGGCGTGAAGGAAGGCAGGGACCCATGGGTCCGCCCGG[T/G]AAGGGGAACTAATGTGCTCCTGTATCCCACAGCGATCCATATTTCCATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: