si:dkey-27a13.3

Ensembl ID:
ENSDARG00000009194
ZFIN IDs:
ZDB-GENE-041111-169, ZDB-GENE-041111-169, ZDB-GENE-060503-446
Description:
Novel protein similar to mouse procollagen, type XVI, alpha 1 (Col16a1) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
COL16A1
Human Description:
collagen, type XVI, alpha 1 [Source:HGNC Symbol;Acc:2193]
Mouse Orthologue:
Col16a1
Mouse Description:
collagen, type XVI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095396]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16684 Nonsense Available for shipment Available now
sa8492 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15494 Nonsense Available for shipment Available now
sa10058 Essential Splice Site Available for shipment Available now
sa12058 Nonsense Available for shipment Available now
sa29247 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36890 Nonsense Mutation detected in F1 DNA During 2018
sa10956 Nonsense Available for shipment Available now
sa43329 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Nonsense 203 1605 5 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40142994)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 39006977
GRCz11 19 38594097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACGTGGACTGCAGCTCCATTGAGAACAARCCTCTGGAGCTCCGCGGC[C/T]AGTTGCCYATCAGTGGACACACRCTGTTGGGGATGAGGGCTACTGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Essential Splice Site 564 1605 None 70
ENSDART00000143284   None 124 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40084696)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38948679
GRCz11 19 38535799
KASP Assay ID:
2261-3594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAGGGAGAGAAGGGAGATCCTGGTGTTGGGCAGAAAGGAGAGCAGG[T/C]GAATGTGATGGACTGATTTCTCATTGACATCCAGCACACATCATTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Nonsense 687 1605 30 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40075337)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38939320
GRCz11 19 38526440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTCTGCATTAAATATCATATCTATGTCTGTAGGGTGATCAGGRTT[T/G]ACAAGGAGACTCAGGTACACCTGGTACACCTGGAGTCGCAGGACCTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Essential Splice Site 759 1605 31 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40074900)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38938883
GRCz11 19 38526003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGARAGAGGAGAGCCGGGTTTGCCAGGCGAGGGCCGAGAAGGRAAACAG[G/T]TGCACAKTTTTTGCTGTCTTTCTMAATTAATTWGTAGTTTTGTTSTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Nonsense 1084 1605 49 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40044978)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38908961
GRCz11 19 38496081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGCAAGGTCAAAGAGGGACAGATGGGAATCCAGGACTGAAGGGCGAA[C/T]AGGTRAGTTAACTGTACTTATGGGTGAAAWATGCTAATTTTGCAGTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Essential Splice Site 1102 1605 50 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40044840)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38908823
GRCz11 19 38495943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGGAAGTCCTGGCTATCCTGGAACTATGGGACCACCCGGTCTCCCTG[T/C]GAGTAGTTACATCCTGTTGCCATATTGTTCACTAATTGTGCTTTTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Nonsense 1202 1605 56 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40037560)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38901543
GRCz11 19 38488663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGGTGTTGCTGGAGTTGCAGGCCCACAGGGGCCCACAGGTCCTCCA[G/T]GATCACCAGGGTCCCCAGGCATGCCTGTGAGTGCTAATAGGTTTTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Nonsense 1227 1605 57 70
ENSDART00000143284   None 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40037369)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38901352
GRCz11 19 38488472
KASP Assay ID:
2261-3589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCACCTGGAATGGAAGGACTTGATGGCAAAGATGGAAAACCAGGTT[T/A]AAGGGTCAGAAAAAMACTCTCATACAGTCTCCCATAGTTTTTNCTGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013049   None 232 None 10
ENSDART00000086717 Essential Splice Site 1515 1605 None 70
ENSDART00000143284 Essential Splice Site 58 124 None 3
Genomic Location (Zv9):
Chromosome 19 (position 40024578)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38888561
GRCz11 19 38475681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGGCAGATTGGGCGTGAAGGAAGGCAGGGACCCATGGGTCCGCCCGG[T/G]AAGGGGAACTAATGTGCTCCTGTATCCCACAGCGATCCATATTTCCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link