ppp1r13b

Ensembl ID:
ENSDARG00000009142
ZFIN ID:
ZDB-GENE-030131-4327
Description:
apoptosis-stimulating of p53 protein 1 [Source:RefSeq peptide;Acc:NP_001038289]
Human Orthologue:
PPP1R13B
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 13B [Source:HGNC Symbol;Acc:14950]
Mouse Orthologue:
Ppp1r13b
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 13B Gene [Source:MGI Symbol;Acc:MGI:1336199]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43417 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37008 Nonsense Available for shipment Available now
sa39275 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1183 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa43417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047662 Essential Splice Site 53 1069 4 18
Genomic Location (Zv9):
Chromosome 20 (position 20838154)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20866321
GRCz11 20 20765994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGTGATTTTTAAAGTGGTTTGTTGTTTTAATGTTCTCCCCTCTCC[A/T]GAGCGAGCCATTCCCTTTGACCACATGATGTATGAGCACCTGCAGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047662 Nonsense 74 1069 4 18
Genomic Location (Zv9):
Chromosome 20 (position 20838218)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20866385
GRCz11 20 20766058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGACCACATGATGTATGAGCACCTGCAGAAATGGGGCCCTAGGAAG[C/T]AAGAGGTCAAGTTCTACCTACGCCATGAAGACTCGCCCACCGAAAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047662 Essential Splice Site 116 1069 5 18
Genomic Location (Zv9):
Chromosome 20 (position 20841010)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20869177
GRCz11 20 20768850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGCAGGAGAGGAGGAAGCAGCTCAGACACGCACAACGAGAACGGGG[T/C]TAGTTCATATCTCATCCTCATCAAAATGTGTGCCTTCTTTTCTAATCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1183
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047662 Nonsense 648 1069 13 18
Genomic Location (Zv9):
Chromosome 20 (position 20877267)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20905434
GRCz11 20 20805107
KASP Assay ID:
554-1093.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCTGGATTTTGAGCTGGACCTCGACGGTCAACTCATAGGCGTACCT[G/T]AACCACCTGCTCCCAGTGTGGACCACATCCCTCGACCCCTCAGCCCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link