zgc:64042

Ensembl ID:
ENSDARG00000009133
ZFIN ID:
ZDB-GENE-040426-1347
Description:
hypothetical protein LOC393609 [Source:RefSeq peptide;Acc:NP_956930]
Human Orthologue:
MYO1E
Human Description:
myosin IE [Source:HGNC Symbol;Acc:7599]
Mouse Orthologue:
Myo1e
Mouse Description:
myosin IE Gene [Source:MGI Symbol;Acc:MGI:106621]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36216 Essential Splice Site Available for shipment Available now
sa42785 Nonsense Mutation detected in F1 DNA During 2018
sa42786 Nonsense Mutation detected in F1 DNA During 2018
sa5626 Nonsense F2 line generated During 2018
sa2862 Nonsense F2 line generated During 2018
sa14037 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Essential Splice Site 394 1096 11 27
Genomic Location (Zv9):
Chromosome 16 (position 40883427)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38268227
GRCz11 16 38218259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGAACATTGGCGTTCTGGATATCTATGGCTTTGAAATATTTCAGG[T/C]GAATTCAGTTTTATTTTAAAATTAAATTTATTTTTTTAATTACTTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Nonsense 651 1096 18 27
Genomic Location (Zv9):
Chromosome 16 (position 40892236)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38277036
GRCz11 16 38227068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCATCTTGACCAGAGAAACATGGCCTCAGTGGCGTGGAGATGAGAAA[C/T]AGGGCGTCCTGCACCTTTTAAAATCTGTCAACATGGACTCAGATCAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Nonsense 696 1096 19 27
Genomic Location (Zv9):
Chromosome 16 (position 40893295)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38278095
GRCz11 16 38228127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGTTGTTCCTGCTGGAGGAGATGAGGGAAAGAAAATACAATGGATA[T/A]GCTCGGGTTATTCAGCAAGCCTGGCGCAAACACATTGCTGTACGGAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5626
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Nonsense 731 1096 20 27
ENSDART00000044971 Nonsense 731 1096 20 27
Genomic Location (Zv9):
Chromosome 16 (position 40893573)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38278373
GRCz11 16 38228405
KASP Assay ID:
554-3071.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGTTCTGATTTCAGCTTCTGACCTCCTGYTGAACAAGAAGGAGAGA[C/T]GAAAGAACAGTCTGAACCGCAATTTCGTCGGAGATTACATCGGCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2862
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Nonsense 731 1096 20 27
ENSDART00000044971 Nonsense 731 1096 20 27
Genomic Location (Zv9):
Chromosome 16 (position 40893573)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38278373
GRCz11 16 38228405
KASP Assay ID:
554-3071.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGTTCTGATTTCAGCTTCTGACCTCCTGCTGAACAAGAAGGAGAGA[C/T]GAAAGAACAGTCTGAACCGCAATTTCGTCGGAGATTACATCGGCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044971 Essential Splice Site 927 1096 23 27
Genomic Location (Zv9):
Chromosome 16 (position 40898840)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38283640
GRCz11 16 38233672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAGATTCTAACTGTCAGTATTGGGTCTGGTCTGYCTAAAAAYACAAG[T/A]AAGTCKGTGTTGAAATGTCAGTACTGTATTTGGATTCCTAGCCCTTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link