
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sh2d3cb
- Ensembl ID:
- ENSDARG00000009081
- ZFIN ID:
- ZDB-GENE-040426-1052
- Description:
- SH2 domain containing 3Cb [Source:RefSeq peptide;Acc:NP_957370]
- Human Orthologue:
- SH2D3C
- Human Description:
- SH2 domain containing 3C [Source:HGNC Symbol;Acc:16884]
- Mouse Orthologue:
- Sh2d3c
- Mouse Description:
- SH2 domain containing 3C Gene [Source:MGI Symbol;Acc:MGI:1351631]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26608 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa20572 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa26608
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003444 | Essential Splice Site | 514 | 635 | 10 | 11 |
ENSDART00000142134 | None | 140 | None | 4 | |
ENSDART00000143500 | None | 232 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 5 (position 67642475)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 64444116 GRCz11 5 65133113 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGCGCTTTAAATACTGTGTGCCAAGCAAGTAACAACTCTCTTTTTTTC[A/T]GCGATAAGCAGGCACACAGAGACAACGTTCCCCCATGTGCTCCCCCTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20572
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000003444 | Nonsense | 629 | 635 | 11 | 11 |
ENSDART00000142134 | None | 140 | None | 4 | |
ENSDART00000143500 | None | 232 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 5 (position 67633965)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 64435606 GRCz11 5 65124603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCGTTACTCCAAGTTTGATGAAGTGCTGACAGCTCTGTCTAACAGACTC[G/T]AGCTTTCACACTCTGCAAAATGAAGGGATGAACTCTATTCACTTTTATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: