zgc:73324

Ensembl ID:
ENSDARG00000009040
ZFIN ID:
ZDB-GENE-040426-1760
Description:
Coenzyme Q-binding protein COQ10 homolog, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6PBN4]
Human Orthologues:
COQ10A, COQ10B
Human Descriptions:
coenzyme Q10 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:26515]
coenzyme Q10 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:25819]
Mouse Orthologues:
Coq10a, Coq10b
Mouse Descriptions:
coenzyme Q10 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:2684847]
coenzyme Q10 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915126]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40031 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013540 Nonsense 147 233 3 5
Genomic Location (Zv9):
Chromosome 3 (position 17758261)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17879581
GRCz11 3 18029321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAATTGTGGAAAGATACACCTCTGAGGTCACAGTCATCCCCAACCAC[C/T]AAGTCCGGGTAAGTCTAAGAACTATGAATTAGAGCAAATCAATGTAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link