zgc:123275

Ensembl ID:
ENSDARG00000008948
ZFIN ID:
ZDB-GENE-051113-96
Description:
group 3 secretory phospholipase A2 [Source:RefSeq peptide;Acc:NP_001032489]
Human Orthologue:
PLA2G3
Human Description:
phospholipase A2, group III [Source:HGNC Symbol;Acc:17934]
Mouse Orthologue:
Pla2g3
Mouse Description:
phospholipase A2, group III Gene [Source:MGI Symbol;Acc:MGI:2444945]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21641 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003242 Essential Splice Site 463 528 6 7
Genomic Location (Zv9):
Chromosome 10 (position 3538498)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3530692
GRCz11 10 3530996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCCTGCTTCAGTCTTCCAAAGTTTGAGGACTGTCTCAATGGACAAAG[G/A]TACAAACGTTATGGCTTAATTTGGACTGTGGAAGGGATAGTTTACCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link