slc8a2a

Ensembl ID:
ENSDARG00000008912
ZFIN ID:
ZDB-GENE-060531-155
Description:
solute carrier family 8 (sodium-calcium exchanger), member 2a [Source:RefSeq peptide;Acc:NP_0011167
Human Orthologue:
SLC8A2
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 2 [Source:HGNC Symbol;Acc:11069]
Mouse Orthologue:
Slc8a2
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 2 Gene [Source:MGI Symbol;Acc:MGI:107996]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33653 Nonsense Mutation detected in F1 DNA During 2018
sa7572 Missense Mutation detected in F1 DNA During 2018
sa9489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Nonsense 45 891 1 11
ENSDART00000145182 Nonsense 7 859 1 12
Genomic Location (Zv9):
Chromosome 5 (position 38471043)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36270727
GRCz11 5 36870880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTAGTGCTGATGGACCCAAGAAACCCTGCTTTGAGAAAGTCAAGTG[T/A]CAGCCAGGGATTCTGCTTCCTGTGTGGCTGCCGCATGACCCCCCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Missense 105 891 2 11
ENSDART00000145182 Missense 67 859 2 12
Genomic Location (Zv9):
Chromosome 5 (position 38473790)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36273474
GRCz11 5 36873627
KASP Assay ID:
554-4302.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTACCCATACRGTGTTATTCTGTGTCCTATAGGAGAAAGARGTGACTG[T/C]GACCGGTGCAAATGGAGAGAAGACCGTAATGACTGTAAGAATCTGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046362 Nonsense 543 891 6 11
ENSDART00000145182 Nonsense 505 859 6 12
Genomic Location (Zv9):
Chromosome 5 (position 38484070)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36283754
GRCz11 5 36883907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGGTGAACCGRACGTCAGGTGTGCGCGGGACTGTGATGATTCCCTA[T/A]CACACAGAGGACGGCTCTGCGCGACARGGGGTTGACTATGAGCAAATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link