smarca2

Ensembl ID:
ENSDARG00000008904
ZFIN ID:
ZDB-GENE-030131-5964
Description:
probable global transcription activator SNF2L2 isoform 2 [Source:RefSeq peptide;Acc:NP_001038240]
Human Orthologue:
SMARCA2
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 [S
Mouse Orthologue:
Smarca2
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 Ge

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26560 Nonsense Mutation detected in F1 DNA During 2018
sa33690 Nonsense Mutation detected in F1 DNA During 2018
sa2224 Nonsense F2 line generated During 2018
sa33691 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20515 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 148 1568 4 34
ENSDART00000113738 Nonsense 148 258 4 5
ENSDART00000136002 Nonsense 148 170 4 4
Genomic Location (Zv9):
Chromosome 5 (position 46801888)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44583153
GRCz11 5 45183306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGGAGCATGTGCCTAGCCCCATGTCAGGAGGAGGGCCGACCCCGCCA[C/T]AAATGTCCCAGGGTCAGTCGCCCATGATGCCAATGGATCCGCAGGGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 317 1568 6 34
ENSDART00000113738   None 258 None 5
ENSDART00000136002   None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46811231)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44592496
GRCz11 5 45192649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCTCCCTCACCTCCCAGCCCCAACCTCAACCACCGGCAGGACCTGGG[C/T]AGCCCTCCCTCATTATCCAGCTCCAGCAGAAACAGAATCGCGTTACCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2224
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 405 1568 8 34
ENSDART00000113738   None 258 None 5
ENSDART00000136002   None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46818146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44599411
GRCz11 5 45199564
KASP Assay ID:
554-2838.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTCTTTCTTTTTCAGCTGAGGCTAGATGTTGTAGCCTGTATGCGC[C/T]GAGACACAACTCTTGAAACAGCCCTGAACTCCAAGGCATACAAGCGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Essential Splice Site 1044 1568 23 34
ENSDART00000113738   None 258 None 5
ENSDART00000136002   None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46848959)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44630224
GRCz11 5 45230377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAATCCTTTGCTGAACATTTGGGATTTCCAAATGGCATTATCAGCGGG[T/G]GAGTATACATCAAATCGAGCGTTACATAACCTTAAGAGTTACCATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041412 Nonsense 1053 1568 24 34
ENSDART00000113738   None 258 None 5
ENSDART00000136002   None 170 None 4
Genomic Location (Zv9):
Chromosome 5 (position 46849148)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44630413
GRCz11 5 45230566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTTTTTTTCTTGTCCACCTAGCCCTGACCTGTACCGAGCCTCTGGC[A/T]AGTTTGAGTTACTGGACCGCATCCTGCCCAAACTGAAGGCCACCAATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link