
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ctns
- Ensembl ID:
- ENSDARG00000008890
- ZFIN ID:
- ZDB-GENE-050522-352
- Description:
- cystinosin [Source:RefSeq peptide;Acc:NP_001018407]
- Human Orthologue:
- CTNS
- Human Description:
- cystinosis, nephropathic [Source:HGNC Symbol;Acc:2518]
- Mouse Orthologue:
- Ctns
- Mouse Description:
- cystinosis, nephropathic Gene [Source:MGI Symbol;Acc:MGI:1932872]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1921 | Essential Splice Site | F2 line generated | During 2018 |
sa14661 | Nonsense | Available for shipment | Available now |
sa4403 | Essential Splice Site | F2 line generated | During 2018 |
sa21844 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1921
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002459 | Essential Splice Site | 193 | 384 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 6324066)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 6292249 GRCz11 11 6289504 - KASP Assay ID:
- 554-1910.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATCGTCAACAAGCAGTTCTGATATACAGATGTTAAATGGTGTATTTCC[A/C]GGAGGAATTCTTGAAGAAAGATCCAAACGGAGTCAWTCCTGTGGATGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14661
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002459 | Nonsense | 236 | 384 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 6324593)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 6292776 GRCz11 11 6290031 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTTATTAATACNNNNTTTTTTTGYTTGTTTTGTTTTCAGAGAGGTGGG[C/T]AAAAGGTYWCCAAAGTGGCCATTGGGTTATTAGCTATCGGCTGGACCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4403
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002459 | Essential Splice Site | 329 | 384 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 6327557)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 6295740 GRCz11 11 6292995 - KASP Assay ID:
- 554-3604.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGGGCAGTTTCAGTTTGATCCAGATGTTCCTTGAGGCCTATAACAATGG[T/C]GAGACCACACAAACACTGYCATGTYCTATTTACGGTAAGGGTGGTCATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21844
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002459 | Nonsense | 342 | 384 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 6327905)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 6296088 GRCz11 11 6293343 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTCTTGACAGATAAATGGAGGTTTATATTTGGAGACCCTACTAAGTTC[G/T]GACTGGGCGTCTTTTCCATATTCTTCGACATTTTGTTCATCATACAGCAT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: