si:dkey-46g23.5

Ensembl ID:
ENSDARG00000008835
ZFIN ID:
ZDB-GENE-030131-9306
Description:
LOC562067 protein [Source:UniProtKB/TrEMBL;Acc:A7MC24]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45125 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021286 Nonsense 289 747 7 18
ENSDART00000078886 Nonsense 995 1453 24 35
Genomic Location (Zv9):
Chromosome 3 (position 3969768)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3654318
GRCz11 3 3436571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGGTGAACAGAACATGATCATTCTCGCTCCCAATATTTACATCCTA[C/T]GATATCTGACAGTAACTGCACAGCTCACCCCAGTCATCCGAGACACTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link