
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
chga
- Ensembl ID:
- ENSDARG00000008829
- ZFIN ID:
- ZDB-GENE-041010-161
- Description:
- chromogranin-A [Source:RefSeq peptide;Acc:NP_001006059]
- Human Orthologue:
- CHGA
- Human Description:
- chromogranin A (parathyroid secretory protein 1) [Source:HGNC Symbol;Acc:1929]
- Mouse Orthologue:
- Chga
- Mouse Description:
- chromogranin A Gene [Source:MGI Symbol;Acc:MGI:88394]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa29374 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa29374
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016014 | Nonsense | 157 | 369 | 6 | 8 |
ENSDART00000062078 | None | 273 | None | 7 | |
ENSDART00000126919 | None | 246 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 27063407)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 27134710 GRCz11 20 27033800 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCGAGGAGCAGGAGAGGAGAGCGAGGAGACAGAGCAGCAGTCTCAGAAA[C/T]AAAACCAGATTATTACTGAGGAAGACCACAGTAAGGAACAAGAAGAAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: