zgc:158823

Ensembl ID:
ENSDARG00000008790
ZFIN ID:
ZDB-GENE-070424-10
Description:
actin-related protein 3B [Source:RefSeq peptide;Acc:NP_001083025]
Human Orthologues:
ACTR3B, ACTR3C
Human Descriptions:
ARP3 actin-related protein 3 homolog B (yeast) [Source:HGNC Symbol;Acc:17256]
ARP3 actin-related protein 3 homolog C (yeast) [Source:HGNC Symbol;Acc:37282]
Mouse Orthologue:
Actr3b
Mouse Description:
ARP3 actin-related protein 3 homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:2661120]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24442 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045150 Essential Splice Site 394 425 11 12
ENSDART00000130982 Essential Splice Site 388 419 11 12
Genomic Location (Zv9):
Chromosome 24 (position 7408491)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7265783
GRCz11 24 7295102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGCAGCGATACGCAGTGTGGTTTGGCGGATCTATGTTGGCTTCTACG[G/A]TAATGTTCATATATATTACATTATTTTTCTGTCTATTTACTCTGAATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link