zgc:56223

Ensembl ID:
ENSDARG00000008784
ZFIN ID:
ZDB-GENE-040426-947
Description:
hypothetical protein LOC393182 [Source:RefSeq peptide;Acc:NP_956507]
Human Orthologue:
PRPF4B
Human Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) [Source:HGNC Symbol;Acc:17346]
Mouse Orthologue:
Prpf4b
Mouse Description:
PRP4 pre-mRNA processing factor 4 homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:109584]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31285 Nonsense Available for shipment Available now
sa19802 Essential Splice Site Available for shipment Available now
sa15327 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762 Nonsense 205 490 2 5
ENSDART00000098834 Nonsense 247 986 2 15
Genomic Location (Zv9):
Chromosome 2 (position 32542697)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32841604
GRCz11 2 32824822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAATCAGCGAGAGACCTAGTGGTCCCAGTGAAACGAAGGAAAGGAGA[C/T]GATCAAGGAGCACTGACAGATCCAAAGATAGAAGTCGTAGGTCCAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762   None 490 None 5
ENSDART00000098834 Essential Splice Site 503 986 4 15
Genomic Location (Zv9):
Chromosome 2 (position 32539363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32838270
GRCz11 2 32821488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTCTGAAGGAATGAAGGCTGAGCAGGAGGACTCGGATGAGGAAGT[G/A]TGAGTATCAAGGAAAGCTGTTTTGCTTTTTATGTTGTGGATGATATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019762   None 490 None 5
ENSDART00000098834 Nonsense 575 986 6 15
Genomic Location (Zv9):
Chromosome 2 (position 32538636)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32837543
GRCz11 2 32820761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCMCCTGATGACATTCTTGAGCGTGTGGCTGCTGATGTCAAAGCYTA[T/A]GAGCAAGAGAACCTGGACACATTTGAGGATAATGTGAAGGCCAAGTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link