zgc:66479

Ensembl ID:
ENSDARG00000008732
ZFIN ID:
ZDB-GENE-031030-10
Description:
hypothetical protein LOC327541 [Source:RefSeq peptide;Acc:NP_942576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8924 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011970 Nonsense 228 612 2 4
Genomic Location (Zv9):
Chromosome 6 (position 46676739)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46737673
GRCz11 6 46739555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCACATCTGAGCTGGAGGAACAAAGAATTGAACTTACAAGCCTGAAG[G/T]AATCTTTTGCCAGCAATAAAAAGGCTCTTCAAAGAAACAGACAGGAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link