zgc:73265

Ensembl ID:
ENSDARG00000008706
ZFIN ID:
ZDB-GENE-040426-1736
Description:
polyadenylate-binding protein-interacting protein 2B [Source:RefSeq peptide;Acc:NP_957060]
Human Orthologue:
PAIP2B
Human Description:
poly(A) binding protein interacting protein 2B [Source:HGNC Symbol;Acc:29200]
Mouse Orthologue:
Paip2b
Mouse Description:
poly(A) binding protein interacting protein 2B Gene [Source:MGI Symbol;Acc:MGI:2386865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010211 Nonsense 74 131 3 4
ENSDART00000122333 Nonsense 74 149 3 5
ENSDART00000135280 Nonsense 74 131 3 4
Genomic Location (Zv9):
Chromosome 1 (position 41851453)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40767694
GRCz11 1 41470481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAGCTGTTGGAGCAGGAGTTTCTTGAACGCTGTTTCCAGGAGATGT[T/A]GGAGGAGGAGGATCAAGATTGGTTCATTCCTGCCAGAGACCTTCCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link