zgc:101095

Ensembl ID:
ENSDARG00000008639
ZFIN ID:
ZDB-GENE-040912-74
Description:
kinesin-associated protein 3 [Source:RefSeq peptide;Acc:NP_001004644]
Human Orthologue:
KIFAP3
Human Description:
kinesin-associated protein 3 [Source:HGNC Symbol;Acc:17060]
Mouse Orthologue:
Kifap3
Mouse Description:
kinesin-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:107566]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13979 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005609 Essential Splice Site 462 789 12 20
Genomic Location (Zv9):
Chromosome 20 (position 34456388)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34528901
GRCz11 20 34431780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATCAACCTGGCTGCCAACAGGAGGAACACCCAGATCATGTGTGAAG[G/A]TAAGAATATGCACAAATGCACAACCTAAAAACATAGAAGATCCTACTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link