nbas

Ensembl ID:
ENSDARG00000008593
ZFIN ID:
ZDB-GENE-041014-367
Description:
Neuroblastoma-amplified sequence [Source:UniProtKB/Swiss-Prot;Acc:Q5TYW4]
Human Orthologue:
NBAS
Human Description:
neuroblastoma amplified sequence [Source:HGNC Symbol;Acc:15625]
Mouse Orthologue:
Nbas
Mouse Description:
neuroblastoma amplified sequence Gene [Source:MGI Symbol;Acc:MGI:1918419]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5954 Nonsense Mutation detected in F1 DNA During 2018
sa45707 Nonsense Mutation detected in F1 DNA During 2018
sa37082 Nonsense Mutation detected in F1 DNA During 2018
sa9535 Essential Splice Site Available for shipment Available now
sa37081 Nonsense Mutation detected in F1 DNA During 2018
sa17866 Nonsense Available for shipment Available now
sa37080 Nonsense Mutation detected in F1 DNA During 2018
sa16290 Nonsense Available for shipment Available now
sa16834 Nonsense Available for shipment Available now
sa23747 Nonsense Available for shipment Available now
sa23746 Nonsense Available for shipment Available now
sa32302 Nonsense Available for shipment Available now
sa23745 Nonsense Available for shipment Available now
sa23744 Essential Splice Site Available for shipment Available now
sa43479 Nonsense Mutation detected in F1 DNA During 2018
sa8739 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 18 2372 1 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33213728)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33271968
GRCz11 20 33174847
KASP Assay ID:
554-3731.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGTGATATTATTCTAGAAGACGAGGAGGAGAACATTTTATATGATT[T/G]ACTTGTTAACACGGAATGGCCGCCCGAAACAGACACTCAGGTTTGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 79 2372 4 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33207527)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33265767
GRCz11 20 33168646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAACTCTTCCACCTGGTCTGGTTCGCCTCGCAACTAAACAGGTGAACT[G/A]GCAGCTGGTGTTGGCAAGGTAAAAACAGACTGTTTTTAACACATAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 679 2372 19 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33157492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33215732
GRCz11 20 33118611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGAGCAGAAGGAGCTCTGCAGGAGTAGACTCAAGCTTCTCTGCTA[T/A]CTGGACCGCTTGGCCACTTATGAGGTATAACACTCTTCACATAGTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Essential Splice Site 1075 2372 29 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33099648)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33157888
GRCz11 20 33060767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCCCAGAACACTCATRTGCACCTGTTCCACTGTTTGTTTTTTNGCTT[A/T]GAAACCCTCCTGTGAGTGAGACCGTGTGGAGAAGTTTACTTCAAGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1109 2372 29 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33099546)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33157786
GRCz11 20 33060665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATGCAGCAGAATGTGTACACCTGTCTAGAGCCAGAGACTTGCCAT[C/T]AGGTACTAAATGATACTAAAATATATAATAATTGTGCAGTATCGCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1117 2372 30 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33092487)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33150727
GRCz11 20 33053606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAAATGTGTCTCTCATCTGCACAGGTGTTTGTAGAGAGCCTGTTGTG[T/A]TCGAGCCKAGAGGAGAATGTGCGTCTGGCGGGTCAGTTGATGCACTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1265 2372 33 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33064086)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33122326
GRCz11 20 33025205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATATGTAAAAGTGTGTGCATGCTTGTGTGTGTGTTTTAGGTGATGAT[G/T]AGGCCAAGAGAAAGGGTCAGGTGCTTACACTGTTGGCAGAACAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1439 2372 37 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33051733)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33109973
GRCz11 20 33012852
KASP Assay ID:
2261-4573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACCATGAGCACCAAAGCTGTCCTGACCACCGTCATCGACTCTCACT[G/A]GTGGAGAGAGTCCCTCAGCCTGCTTCGCCCACTGCACGTAAGTCTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1550 2372 40 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 33037905)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33096145
GRCz11 20 32999024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTAGCCAGTGATGCTTTTCCCAAAGATATGACACTCGCCCTGGCCTA[T/A]TTACTRGCTCTACCTCAGGTGAGTCTGACTGCTCTATTTGCAGATCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1816 2372 45 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32987542)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33045782
GRCz11 20 32948661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCTAGGTCTGGACTATAAGAAGATGACAGAGGAAAATTCAGATCCTT[T/A]GAAAGCTCTGGAGCCGATACTGACCAGCCAGAACGTCCTGTCCATCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1840 2372 45 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32987471)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33045711
GRCz11 20 32948590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCAGCCAGAACGTCCTGTCCATCTCCAAACTGGCCTCTCGAATCCCC[C/T]AGAAGGGAGGTGAAGCTCTAACCTCCAGCGCTGTTCATTCCACCTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1901 2372 45 53
ENSDART00000138708   None 154 None 3
ENSDART00000047834 Nonsense 1901 2372 45 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32987287)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33045527
GRCz11 20 32948406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCCAAATATTTTGACCGACTGCTGCCTGTGGATTTTGTCAATTTTT[T/A]GGATGCCATCACCTTTTCACCTGAAGCAGCCAATAAGGTGAGTCGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 1901 2372 45 53
ENSDART00000138708   None 154 None 3
ENSDART00000047834 Nonsense 1901 2372 45 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32987287)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33045527
GRCz11 20 32948406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCCAAATATTTTGACCGACTGCTGCCTGTGGATTTTGTCAATTTTT[T/A]GGATGCCATCACCTTTTCACCTGAAGCAGCCAATAAGGTGAGTCGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Essential Splice Site 2081 2372 48 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32966030)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33024270
GRCz11 20 32927149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTACTGGAAGGAATAGTTGCAGTGGTGCACACTAATGTACAAAGCGG[G/A]TACGTTTGTCCTTTGTTGCTATGTTCTCGTTTTTATTATTGAAGCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 2273 2372 52 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32902233)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32960473
GRCz11 20 32863352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCCTGCTCTGAAGTTGATGACTGAAAGCAAAGATGAGCATTTGCTC[A/T]AACTGACCCAAGATCAGATCAGAAATATCACTGAGGTAAGTTTCATTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047834 Nonsense 2351 2372 53 53
ENSDART00000138708   None 154 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32877414)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32935654
GRCz11 20 32838533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAACAGGCTGGACACAGTGCTCAGGCCGGYTCCTTGCTCCTGTCCTA[T/A]CGCGGATCTCACCCAGGACAATTTACATTCAACAGCGYCCTTGCCGTCRY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link