
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-159p3.3
- Ensembl ID:
- ENSDARG00000008548
- ZFIN IDs:
- ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-050809-38, ZDB-GENE-070912-125
- Description:
- Rho GTPase activating protein 12a [Source:RefSeq peptide;Acc:NP_001119879]
- Human Orthologue:
- ARHGAP12
- Human Description:
- Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
- Mouse Orthologue:
- Arhgap12
- Mouse Description:
- Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33007 | Essential Splice Site | Available for shipment | Available now |
sa25119 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19855 | Nonsense | Available for shipment | Available now |
sa18172 | Essential Splice Site | Available for shipment | Available now |
sa17967 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33007
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050403 | Essential Splice Site | 445 | 831 | 6 | 17 |
ENSDART00000135836 | None | 488 | None | 10 | |
ENSDART00000138620 | Essential Splice Site | 240 | 261 | 6 | 7 |
ENSDART00000142804 | Essential Splice Site | 445 | 831 | 7 | 18 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43841044)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43926545 GRCz11 2 43779543 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTCCGCGCCGCAAAACCACCTTGCGCTCTCACCCTTATTTTCCACAAG[T/G]CAGTGTTGCCTCGCCACTATATTCCAGCCGCCAATCACATCGGATGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25119
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050403 | Essential Splice Site | 466 | 831 | None | 17 |
ENSDART00000135836 | Essential Splice Site | 370 | 488 | None | 10 |
ENSDART00000138620 | 261 | 261 | None | 7 | |
ENSDART00000142804 | Essential Splice Site | 466 | 831 | None | 18 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43845521)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43931022 GRCz11 2 43784020 - KASP Assay ID:
- 554-7400.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGCCACTTTAAACATGACTAAAATCACTGAACATGGAAAGAAAGTCCGG[T/A]AAGTAGAACCAATCAGGTAGAGAGAGAGCTAGAAATGCTTCCATCTACGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19855
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050403 | Nonsense | 509 | 831 | 9 | 17 |
ENSDART00000135836 | Nonsense | 413 | 488 | 8 | 10 |
ENSDART00000138620 | None | 261 | None | 7 | |
ENSDART00000142804 | Nonsense | 509 | 831 | 10 | 18 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43845820)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43931321 GRCz11 2 43784319 - KASP Assay ID:
- 2259-2538.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAGTTTGGAAGAGACCAGAAGAGTTCAGTGGAGTACAGTGTGGATCTC[A/T]AAGGAGGGTCGGTGGACTGGGCGTCTAAAGACAAATCCAGCAAGAAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18172
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050403 | Essential Splice Site | 635 | 831 | 12 | 17 |
ENSDART00000135836 | None | 488 | None | 10 | |
ENSDART00000138620 | None | 261 | None | 7 | |
ENSDART00000142804 | Essential Splice Site | 635 | 831 | 13 | 18 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43853096)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43938597 GRCz11 2 43791595 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTGGCAGACCTACTTTACAAGCTGTCAAAGACAAAGGCTACATTAAAGG[T/C]ATTACACRCACCTATAAGCAGACACAGTKTTATGTTTAAAATTCAGACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17967
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050403 | Essential Splice Site | 668 | 831 | 13 | 17 |
ENSDART00000135836 | None | 488 | None | 10 | |
ENSDART00000138620 | None | 261 | None | 7 | |
ENSDART00000142804 | Essential Splice Site | 668 | 831 | 14 | 18 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43853286)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43938787 GRCz11 2 43791785 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGTCCCCCGCTTTGTCTGGTTGTGCATTGAGCAAGTGGAGAAGAACGG[T/A]ACTTCTCAATCNTTTTTTTTGTTTTAGTAACTTTACAGGTKTTTAATATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: