yod1

Ensembl ID:
ENSDARG00000008542
ZFIN ID:
ZDB-GENE-050417-217
Description:
Ubiquitin thioesterase OTU1 [Source:UniProtKB/Swiss-Prot;Acc:Q567B1]
Human Orthologue:
YOD1
Human Description:
YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25035]
Mouse Orthologue:
Yod1
Mouse Description:
YOD1 OTU deubiquitinating enzyme 1 homologue (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442596

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023388 Nonsense 168 301 3 3
ENSDART00000142734   None 46 None 3
Genomic Location (Zv9):
Chromosome 11 (position 38877468)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37444487
GRCz11 11 37711692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGCCGTTTTGGGCAAAACCAATGAAGAATACTGCACATGGATCCGT[C/T]GAGATGACACGTGGGGAGGCGCCATTGAAGTTTCCATCCTCTCCAAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link