zgc:63792

Ensembl ID:
ENSDARG00000008541
ZFIN IDs:
ZDB-GENE-030131-9279, ZDB-GENE-071004-113
Description:
acidic chitinase [Source:RefSeq peptide;Acc:NP_956740]
Human Orthologue:
OVGP1
Human Description:
oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
Mouse Orthologue:
Ovgp1
Mouse Description:
oviductal glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:106661]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37660 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43941 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24287 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012540 Essential Splice Site None 475 1 12
ENSDART00000104618   None 481 None 11
ENSDART00000125486   None 481 None 11

The following transcripts of ENSDARG00000008541 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 18097252)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18000191
GRCz11 23 17926534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGTGAGGGAAAAACAAAGGAGACTGGAGACCTGAGCGACAGAACAG[G/T]TAAATAGTAACATTGTAGTGATCGTTTTTATGCTCTTCTTACTCTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012540   None 475 None 12
ENSDART00000104618 Essential Splice Site 86 481 3 11
ENSDART00000125486   None 481 None 11

The following transcripts of ENSDARG00000008541 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 18113487)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18016426
GRCz11 23 17942769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGGAATGATGAAACTCTCTACCAGTCCTTTAATGGCCTAAAACAAAG[G/A]TGCGCTTATGTTTTTTCCATGCATATATTTGTTTAATCTACTATGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012540   None 475 None 12
ENSDART00000104618 Essential Splice Site 343 481 9 11
ENSDART00000125486   None 481 None 11

The following transcripts of ENSDARG00000008541 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 18117819)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18020758
GRCz11 23 17947101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACAGGAGTGGGTGGGATTTGATGACCAGGAAAGCTATGAGACTAAGG[T/A]GAGTATGCTAAAGTATAAAACATAAATGTATTTCTCATGCTCTCGGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link