zgc:195027

Ensembl ID:
ENSDARG00000008485
ZFIN ID:
ZDB-GENE-080723-53
Description:
hypothetical protein LOC100170796 [Source:RefSeq peptide;Acc:NP_001124106]
Human Orthologue:
LRP3
Human Description:
low density lipoprotein receptor-related protein 3 [Source:HGNC Symbol;Acc:6695]
Mouse Orthologue:
Lrp3
Mouse Description:
low density lipoprotein receptor-related protein 3 Gene [Source:MGI Symbol;Acc:MGI:3584516]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7077 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40956 Nonsense Mutation detected in F1 DNA During 2018
sa7078 Nonsense Mutation detected in F1 DNA During 2018
sa38628 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016265 Essential Splice Site None 820 1 9
Genomic Location (Zv9):
Chromosome 7 (position 39671101)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38007741
GRCz11 7 38278999
KASP Assay ID:
554-4996.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCGTCCACAAGAGWGCAGGCTTTCACTTCCACAGTCCCGACAGCTGG[T/G]AAGTCTCCATCAGACAAATGATGAAAACAAACCCAAGCAAAATTCATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016265 Nonsense 344 820 6 9
Genomic Location (Zv9):
Chromosome 7 (position 39692612)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38029252
GRCz11 7 38300510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACCACGCTAAACCACACAGCCCCGGACATGGATTCAATGCCACCTA[T/A]CAGGTATCTCATTCTCATATGCTTTCTGGGGTTAAGAAAATGAAAAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016265 Nonsense 376 820 7 9
Genomic Location (Zv9):
Chromosome 7 (position 39695194)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38031834
GRCz11 7 38303092
KASP Assay ID:
554-4983.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGGCTGCTACTCTGATCTGCAGCKCTGTGACGGATACTGGCATTG[T/A]CCTGGTGGTCGAGATGAGGAGGCCTGCCCRCTGTGCCAGCCGGGTGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016265 Nonsense 389 820 7 9
Genomic Location (Zv9):
Chromosome 7 (position 39695231)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38031871
GRCz11 7 38303129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACTGGCATTGTCCTGGTGGTCGAGATGAGGAGGCCTGCCCGCTGTGC[C/T]AGCCGGGTGAGTACCCATGCGAGGGTGGCAGCGGGGCATGTTACTCCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link