zorba

Ensembl ID:
ENSDARG00000008454
ZFIN ID:
ZDB-GENE-990927-1
Description:
Cytoplasmic polyadenylation element-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9YGX5]
Human Orthologue:
CPEB1
Human Description:
cytoplasmic polyadenylation element binding protein 1 [Source:HGNC Symbol;Acc:21744]
Mouse Orthologue:
Cpeb1
Mouse Description:
cytoplasmic polyadenylation element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:108442]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21054 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024062 Essential Splice Site 5 210 None 5
ENSDART00000098904 Essential Splice Site 5 559 None 12
ENSDART00000127007 Essential Splice Site 5 601 None 13
Genomic Location (Zv9):
Chromosome 7 (position 49708173)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47978409
GRCz11 7 48251185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTTCGGTAATTTTGGTTGTTTGACCTGCCATGGCGTTTTCTCTGG[T/G]GAGTAACGATAGTTAAGACAGAGAAAGTCTGCCAGTTCAGTTTCGCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link