pcolce2a

Ensembl ID:
ENSDARG00000008450
ZFIN ID:
ZDB-GENE-070705-25
Description:
Novel protein similar to vertebrate procollagen C-endopeptidase enhancer 2 (PCOLCE2) [Source:UniProt
Human Orthologue:
PCOLCE2
Human Description:
procollagen C-endopeptidase enhancer 2 [Source:HGNC Symbol;Acc:8739]
Mouse Orthologue:
Pcolce2
Mouse Description:
procollagen C-endopeptidase enhancer 2 Gene [Source:MGI Symbol;Acc:MGI:1923727]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19674 Nonsense Available for shipment Available now
sa30591 Nonsense Mutation detected in F1 DNA During 2018
sa45089 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040111 Nonsense 73 423 2 9

The following transcripts of ENSDARG00000008450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 7816203)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8233857
GRCz11 2 8031862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATTGGGAGTCAAGGGTACCCCGCTGTTTACCCACCCAACAACAAATG[T/A]GTGTGGAGAATTACAGTAAGGACAGATGTGTGATTTCTTTAAATGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040111 Nonsense 359 423 8 9

The following transcripts of ENSDARG00000008450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 7827480)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8245134
GRCz11 2 8043139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTTTTTCCATCATGCACCTTTATAAAGAAGGAAATTTAGCCATCCAA[C/T]AAGCTGGGAAAACCATGAGCACCAAAGTTACGGTCCTCTGCAAACAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040111 Essential Splice Site 381 423 8 9

The following transcripts of ENSDARG00000008450 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 7827548)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8245202
GRCz11 2 8043207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCAAAGTTACGGTCCTCTGCAAACAATGCCCGCTGGTCAGAAGAGG[C/T]GAGTATCTTTACACTGATCCATATACAAAAATACCAAGGTTAATCATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link