tfec

Ensembl ID:
ENSDARG00000008423
ZFIN ID:
ZDB-GENE-041210-21
Description:
transcription factor EC [Source:RefSeq peptide;Acc:NP_001025276]
Human Orthologue:
TFEC
Human Description:
transcription factor EC [Source:HGNC Symbol;Acc:11754]
Mouse Orthologue:
Tcfec
Mouse Description:
transcription factor EC Gene [Source:MGI Symbol;Acc:MGI:1333760]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30378 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049863 Nonsense 177 396 6 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 177091)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6034977
GRCz11 4 6043547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGACTGACTTTGTTCTTGAAATTCGCAGTTGAAAGACGGCGGCGATA[C/A]AACATCAACTACAGGATCAAGGAGCTGGGAACACTGATACCCAAATCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link