Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfec
- Ensembl ID:
- ENSDARG00000008423
- ZFIN ID:
- ZDB-GENE-041210-21
- Description:
- transcription factor EC [Source:RefSeq peptide;Acc:NP_001025276]
- Human Orthologue:
- TFEC
- Human Description:
- transcription factor EC [Source:HGNC Symbol;Acc:11754]
- Mouse Orthologue:
- Tcfec
- Mouse Description:
- transcription factor EC Gene [Source:MGI Symbol;Acc:MGI:1333760]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa30378 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30378
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000049863 | Nonsense | 177 | 396 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3539 (position 177091)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 6034977 GRCz11 4 6043547 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTATGACTGACTTTGTTCTTGAAATTCGCAGTTGAAAGACGGCGGCGATA[C/A]AACATCAACTACAGGATCAAGGAGCTGGGAACACTGATACCCAAATCCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
