si:dkey-251i8.1

Ensembl ID:
ENSDARG00000008413
ZFIN ID:
ZDB-GENE-090311-52
Description:
Novel protein similar to vertebrate ATPase, class VI, type 11A (ATP11A) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
ATP11A
Human Description:
ATPase, class VI, type 11A [Source:HGNC Symbol;Acc:13552]
Mouse Orthologue:
Atp11a
Mouse Description:
ATPase, class VI, type 11A Gene [Source:MGI Symbol;Acc:MGI:1354735]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32744 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31231 Essential Splice Site Available for shipment Available now
sa25650 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040284 Essential Splice Site 14 1169 2 30
ENSDART00000145117   1 1124 1 28

The following transcripts of ENSDARG00000008413 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 46841108)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45652769
GRCz11 1 46344001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATATATCTGAATAAATAAATAATGCATGCTGTCTGTCTGTTTGTTTC[A/G]GTGTACAGGAGAGGAGAACTGGGTGGACAGCAGGACGGTTTATATTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040284 Essential Splice Site 54 1169 2 30
ENSDART00000145117 Essential Splice Site 41 1124 1 28

The following transcripts of ENSDARG00000008413 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 46840982)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45652643
GRCz11 1 46343875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTACATTCCACAGAGATTTCCTGACAACAGAATCGTCTCCTCGAAGG[T/G]CAGATGTGAACTACGACAAGCAGTTTTGTATAACCATGACAAGCTGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040284 Nonsense 891 1169 22 30
ENSDART00000145117 Nonsense 878 1124 21 28

The following transcripts of ENSDARG00000008413 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 46798358)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45610019
GRCz11 1 46301251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACTACTATTACATCAGAATCGCTGAGCTGGTCCAGTATTTCTTCTA[T/G]AAGGTGAACCCAAACACTCACAATACAACATACTTCTCCCTACACATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link