spred2

Ensembl ID:
ENSDARG00000008372
ZFIN ID:
ZDB-GENE-040426-2342
Description:
Sprouty-related, EVH1 domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYK3]
Human Orthologue:
SPRED2
Human Description:
sprouty-related, EVH1 domain containing 2 [Source:HGNC Symbol;Acc:17722]
Mouse Orthologue:
Spred2
Mouse Description:
sprouty-related, EVH1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2150019]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35410 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045292 Nonsense 65 413 2 6
ENSDART00000123179 Nonsense 64 412 2 6
Genomic Location (Zv9):
Chromosome 13 (position 5574445)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5768903
GRCz11 13 5897380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGAGCTGACCGGCCGCAGCGACTTCCTCATCCACGGCGAGCGGCTC[A/T]AAGACAAGCAGGTGTGCCACAAATATTCACAGTCTTCCTCTTTAGAGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link