SMARCA4 (2 of 2)

Ensembl ID:
ENSDARG00000008350
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 [S
Human Orthologue:
SMARCA4
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 [S
Mouse Orthologue:
Smarca4
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 Ge

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24812 Nonsense Available for shipment Available now
sa24813 Nonsense Available for shipment Available now
sa44439 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003698 Nonsense 278 678 9 17
Genomic Location (Zv9):
Chromosome Zv9_NA996 (position 3183)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 75195
GRCz11 6 93246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGCCTCGGGGAAGTTCGAGGTGCTGGACCGCATTCTGCCAAAACTA[C/T]GAGCCACAAACCACAAAGTGCTGCTCTTCTGCCAGATGACGTCTCTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003698 Nonsense 441 678 11 17
Genomic Location (Zv9):
Chromosome Zv9_NA996 (position 3901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGTCATGAGCGGCGAGCGTTTCTGCAGGCAATCCTGGAGCACGAGGAG[C/T]AGGACGAGGTGAGGAGGGACAGGACAGCTCACAGTCAGACCAATAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003698 Essential Splice Site 466 678 13 17
Genomic Location (Zv9):
Chromosome Zv9_NA996 (position 7972)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 77634
GRCz11 6 95685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTCTGCTGTAGTTCCTCTGCTGTAGTTCCTCTGCTTTGTGTCCTGC[A/C]GCGGATGGATCTGGACCGCCGGCGTGAGGAGGCGCGGAACCCGAAGCGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link