
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rcor2
- Ensembl ID:
- ENSDARG00000008278
- ZFIN ID:
- ZDB-GENE-040426-1812
- Description:
- REST corepressor 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P116]
- Human Orthologue:
- RCOR2
- Human Description:
- REST corepressor 2 [Source:HGNC Symbol;Acc:27455]
- Mouse Orthologue:
- Rcor2
- Mouse Description:
- REST corepressor 2 Gene [Source:MGI Symbol;Acc:MGI:1859854]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34063 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34063
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002961 | Essential Splice Site | 101 | 536 | 6 | 13 |
The following transcripts of ENSDARG00000008278 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 26152482)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 24714234 GRCz11 7 24985391 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTAGATGGAGGCATTGATCACTTATACTATCCTCCTGCGTTATATCAAC[A/T]GGCTCTTGGCATGCTTCTGTGGCACAAGCATGATGTGGAGAAGTCACTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: