zgc:63606

Ensembl ID:
ENSDARG00000008275
ZFIN ID:
ZDB-GENE-040426-1185
Description:
hypothetical protein LOC393412 [Source:RefSeq peptide;Acc:NP_956734]
Human Orthologue:
KLHL24
Human Description:
kelch-like 24 (Drosophila) [Source:HGNC Symbol;Acc:25947]
Mouse Orthologue:
Klhl24
Mouse Description:
kelch-like 24 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1923035]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44152 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14715 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013211   None 601 None 6
ENSDART00000015628 Essential Splice Site None 398 1 5
ENSDART00000132235 Essential Splice Site None 600 1 7
Genomic Location (Zv9):
Chromosome 24 (position 26585310)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25643667
GRCz11 24 25788708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACACACTAAGGAGACATCCGTAACGAAATCTTAACTTTTTAAACTG[G/A]TGAGTTTTGCTGATGATAACGTTCTATTCTATTCTATTCTATTCTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013211 Nonsense 534 601 5 6
ENSDART00000015628   None 398 None 5
ENSDART00000132235 Nonsense 534 600 6 7
Genomic Location (Zv9):
Chromosome 24 (position 26564587)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25622944
GRCz11 24 25767985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACCCCATTGAAGATTACWGGATGCACGTGGTTCATACGTTCAGYAAA[C/T]AGGTACTAGAYCTTTTTTCCGTAGACAWTCTAAAAACYTAAACTAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link