vps35

Ensembl ID:
ENSDARG00000008224
ZFIN ID:
ZDB-GENE-030131-2042
Description:
vacuolar protein sorting 35 [Source:RefSeq peptide;Acc:NP_001020688]
Human Orthologue:
VPS35
Human Description:
vacuolar protein sorting 35 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:13487]
Mouse Orthologue:
Vps35
Mouse Description:
vacuolar protein sorting 35 Gene [Source:MGI Symbol;Acc:MGI:1890467]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11695 Nonsense Available for shipment Available now
sa9031 Nonsense Mutation detected in F1 DNA During 2018
sa15228 Essential Splice Site Available for shipment Available now
sa40982 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016105 Nonsense 53 796 3 17
ENSDART00000111590 Nonsense 88 854 3 23
ENSDART00000138800 Nonsense 53 108 3 4
Genomic Location (Zv9):
Chromosome 7 (position 44535170)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41525470
GRCz11 7 41805543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAAGCTGATGGATGCACTGAAACAKGCCTCAAATATGCTGGGGGAGT[T/A]GAGGACGTCCATGCTCTCTCCTAARAGCTATTATGAACTCTGTAYGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016105 Nonsense 53 796 3 17
ENSDART00000111590 Nonsense 88 854 3 23
ENSDART00000138800 Nonsense 53 108 3 4
Genomic Location (Zv9):
Chromosome 7 (position 44535170)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41525470
GRCz11 7 41805543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAAGCTGATGGATGCACTGAAACATGCCTCAAATATGCTGGGGGAGT[T/A]GAGGACGTCCATGCTCTCTCCTAARAGCTATTATGAACTCTGTAYGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016105 Essential Splice Site 456 796 11 17
ENSDART00000111590 Essential Splice Site 491 854 11 23
ENSDART00000138800   None 108 None 4
Genomic Location (Zv9):
Chromosome 7 (position 44510448)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41500748
GRCz11 7 41780821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGCAACATTCTGGACTACAACACCATAATCGTGGCCCAAGATCAGG[T/A]TTGTATCACATACGNTGCTTTAACCAGATKTGCTTATTTCTTTTMATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016105 Nonsense 731 796 16 17
ENSDART00000111590 Nonsense 766 854 16 23
ENSDART00000138800   None 108 None 4
Genomic Location (Zv9):
Chromosome 7 (position 44494502)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41484802
GRCz11 7 41764875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAAGTCCAGCTCTTCATCGAGATCCTCAACAGATACATCTGCTTCTA[T/G]GAGCGAGAGAATGATGCGGTATGCCCAGAGACGCTCTTTTATTGTCTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link