syk

Ensembl ID:
ENSDARG00000008186
ZFIN ID:
ZDB-GENE-040702-3
Description:
tyrosine-protein kinase SYK [Source:RefSeq peptide;Acc:NP_998008]
Human Orthologue:
SYK
Human Description:
spleen tyrosine kinase [Source:HGNC Symbol;Acc:11491]
Mouse Orthologue:
Sykb
Mouse Description:
spleen tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:99515]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2568 Essential Splice Site F2 line generated During 2018
sa34824 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2568
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005292 Essential Splice Site 414 585 9 13
ENSDART00000141943 Essential Splice Site 414 585 7 11
Genomic Location (Zv9):
Chromosome 10 (position 5545373)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5541667
GRCz11 10 5541971
KASP Assay ID:
554-3360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTCGCTGAACTGGGGCCGCTTCACAAGTTTCTGCAGAAGAACAAG[T/A]ACGTCATGCTACAAATATGTAATGAGACTTGAGATACTGTGCTGTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005292 Nonsense 552 585 12 13
ENSDART00000141943 Nonsense 552 585 10 11
Genomic Location (Zv9):
Chromosome 10 (position 5541662)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5537956
GRCz11 10 5538260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAACGGACAGCGGATGTCCGCACCGCCCGACTGCCCACCTGAGATGTA[C/A]GACCTCATGAAGAAATGCTGGACATACAAGTAAGTCAACGTTTACTAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link