zgc:91835

Ensembl ID:
ENSDARG00000008170
ZFIN ID:
ZDB-GENE-040704-42
Description:
drebrin-like [Source:RefSeq peptide;Acc:NP_001002201]
Human Orthologue:
DBNL
Human Description:
drebrin-like [Source:HGNC Symbol;Acc:2696]
Mouse Orthologue:
Dbnl
Mouse Description:
drebrin-like Gene [Source:MGI Symbol;Acc:MGI:700006]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41734 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44732 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025691 Essential Splice Site 311 496 10 15

The following transcripts of ENSDARG00000008170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 43731611)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42538106
GRCz11 10 42366486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGCTTGGTCAATGATGCAACATCTTCTCCATCAAGCAGCCGACAGG[G/T]TACAACTAAAACTTCTCCAGCATTTCATAACCCAGAACCTCATTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025691 Essential Splice Site 451 496 14 15

The following transcripts of ENSDARG00000008170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 43735522)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42542017
GRCz11 10 42370397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGACAACCAGAACATCTGCGCAAGAGCACTATATGACTATCAGGCTT[G/T]TGAGTGCCTTTTACTGCATCATATAAAGTCATTAATTTCCCTTCGGCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link