rbl1

Ensembl ID:
ENSDARG00000008141
ZFIN ID:
ZDB-GENE-030131-8179
Description:
retinoblastoma-like protein 1 [Source:RefSeq peptide;Acc:NP_001124082]
Human Orthologue:
RBL1
Human Description:
retinoblastoma-like 1 (p107) [Source:HGNC Symbol;Acc:9893]
Mouse Orthologue:
Rbl1
Mouse Description:
retinoblastoma-like 1 (p107) Gene [Source:MGI Symbol;Acc:MGI:103300]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7051 Nonsense Mutation detected in F1 DNA During 2018
sa33967 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40792 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30879 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8648 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Nonsense 59 1058 2 22
Genomic Location (Zv9):
Chromosome 6 (position 51521789)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51570971
GRCz11 6 51570970
KASP Assay ID:
554-4253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGATCTGTAGGCTGTGTTTGGTTTTCTCAGGGTGATGTYATGCACTG[G/A]CTGGCCTGCTCTCTGTACGCTGCCTGTAGGAARAGCTCCATCCCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 363 1058 9 22
Genomic Location (Zv9):
Chromosome 6 (position 51514868)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51564050
GRCz11 6 51564049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATATATATATATATATATTTGCATCTTCTTCCTGTTTGTGTGCA[G/T]ACGCGTTCCCTTGCTCCCTCTACTCCTCTAACGGGTCGACGGTATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 536 1058 12 22
ENSDART00000073865 Essential Splice Site 536 1058 12 22
Genomic Location (Zv9):
Chromosome 6 (position 51513666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51562848
GRCz11 6 51562847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGATACTGGAAATCTTTCAGATCCCACCTTTCTACTTTTACAAG[G/A]TACAGAACATTGTCAGTATGGAGGATTAAACCTGCAAAAACAATACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Essential Splice Site 536 1058 12 22
ENSDART00000073865 Essential Splice Site 536 1058 12 22
Genomic Location (Zv9):
Chromosome 6 (position 51513666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51562848
GRCz11 6 51562847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTGGATACTGGAAATCTTTCAGATCCCACCTTTCTACTTTTACAAG[G/A]TACAGAACATTGTCAGTATGGAGGATTAAACCTGCAAAAACAATACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073865 Nonsense 780 1058 17 22
Genomic Location (Zv9):
Chromosome 6 (position 51507226)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51556408
GRCz11 6 51556407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCTTATTTCAAGTGCATATGTTCTGTTGCTRCTCCTTTCAGGTGTA[T/A]CATTTAGCCAGTGTGCGTCTGCGAGACCTGTGTCTGAAGCTGGATATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link