
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:76877
- Ensembl ID:
- ENSDARG00000008064
- ZFIN ID:
- ZDB-GENE-040426-2091
- Description:
- Mediator of RNA polymerase II transcription subunit 8 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYT1]
- Human Orthologue:
- MED8
- Human Description:
- mediator complex subunit 8 [Source:HGNC Symbol;Acc:19971]
- Mouse Orthologue:
- Med8
- Mouse Description:
- mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) Gene [Source:MGI Symbol;Acc:M
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40620 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40620
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000013114 | Nonsense | 31 | 166 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 6 (position 2237800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN149858.1 13129 GRCz11 6 2453736 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGTAGCTCGCGTGGCTCATCTGAAAGGTTCCCTTCAGAGTTTCATTTA[T/A]AAACTAGAGAATGAGTACGACAGACTGACGTGGTGAGTAAACCTGAGGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: