zgc:76877

Ensembl ID:
ENSDARG00000008064
ZFIN ID:
ZDB-GENE-040426-2091
Description:
Mediator of RNA polymerase II transcription subunit 8 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYT1]
Human Orthologue:
MED8
Human Description:
mediator complex subunit 8 [Source:HGNC Symbol;Acc:19971]
Mouse Orthologue:
Med8
Mouse Description:
mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40620 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013114 Nonsense 31 166 1 4
Genomic Location (Zv9):
Chromosome 6 (position 2237800)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149858.1 13129
GRCz11 6 2453736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTAGCTCGCGTGGCTCATCTGAAAGGTTCCCTTCAGAGTTTCATTTA[T/A]AAACTAGAGAATGAGTACGACAGACTGACGTGGTGAGTAAACCTGAGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link