skib

Ensembl ID:
ENSDARG00000008034
ZFIN ID:
ZDB-GENE-990715-10
Description:
nuclear oncoprotein skib [Source:RefSeq peptide;Acc:NP_571013]
Human Orthologue:
SKI
Human Description:
v-ski sarcoma viral oncogene homolog (avian) [Source:HGNC Symbol;Acc:10896]
Mouse Orthologue:
Ski
Mouse Description:
ski sarcoma viral oncogene homolog (avian) Gene [Source:MGI Symbol;Acc:MGI:98310]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41845 Nonsense Mutation detected in F1 DNA During 2018
sa9865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103549 Nonsense 225 695 1 7
Genomic Location (Zv9):
Chromosome 11 (position 26762266)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25591091
GRCz11 11 25828707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCGTACCCGAACTCTACACCAGCCCCAACGCGGCGTGCATACAGTGCT[T/A]GGACTGCAGGCTCATGTTCCCGACCCACAAGTTCGTGGTGCACAGTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103549 Nonsense 249 695 1 7
Genomic Location (Zv9):
Chromosome 11 (position 26762193)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25591018
GRCz11 11 25828634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCACAAGTTCGTGGTGCACAGTCATAAAAGGCTGGAGAACAGAACCTG[T/A]CACTGGGGCTTCGACTCGTCCAACTGGAGGGCTTATATTCTTCTAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link