si:dkey-286j20.1

Ensembl ID:
ENSDARG00000008026
ZFIN ID:
ZDB-GENE-030131-6218
Description:
Si:dkey-286j20.1 protein [Source:UniProtKB/TrEMBL;Acc:Q08CN4]
Human Orthologue:
FAM129B
Human Description:
family with sequence similarity 129, member B [Source:HGNC Symbol;Acc:25282]
Mouse Orthologue:
Fam129b
Mouse Description:
family with sequence similarity 129, member B Gene [Source:MGI Symbol;Acc:MGI:2442910]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1604 Nonsense Available for shipment Available now
sa33620 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016628 Nonsense 292 740 9 15
Genomic Location (Zv9):
Chromosome 5 (position 30564116)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28325905
GRCz11 5 28926058
KASP Assay ID:
554-1545.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACGGCCTGGTTCAGAGTCAGGCTCAGGCTCAGTATGAAGCTGTAGTG[C/T]AGAGCTGTGAAGCAGGTCGACCTCCTCTTGAAACCACCATCCGCACAGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016628 Nonsense 481 740 13 15
Genomic Location (Zv9):
Chromosome 5 (position 30558262)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28320051
GRCz11 5 28920204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTTAATTTTTGTGTTTATTCCACATTGGTTCTCTAGAAATTTGACTA[T/G]GACAGCAGCACTGTTCGTAAGAAGTTCTTCAGAGAGGCACTTCTGCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link