zgc:55995

Ensembl ID:
ENSDARG00000008022
ZFIN ID:
ZDB-GENE-040426-862
Description:
kinesin-like protein KIF18A [Source:RefSeq peptide;Acc:NP_956533]
Human Orthologue:
KIF18A
Human Description:
kinesin family member 18A [Source:HGNC Symbol;Acc:29441]
Mouse Orthologue:
Kif18a
Mouse Description:
kinesin family member 18A Gene [Source:MGI Symbol;Acc:MGI:2446977]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13431 Nonsense Available for shipment Available now
sa6080 Nonsense Mutation detected in F1 DNA During 2018
sa20983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023568 Nonsense 157 895 3 18
ENSDART00000134521 Nonsense 157 182 3 4
Genomic Location (Zv9):
Chromosome 7 (position 33353346)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31747686
GRCz11 7 32018836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATGGACCTCATCAAGGAAGATAAAGTGTTCAATGTAGCCTTTTCTTA[T/A]CTTGAGGTGAGGTTTTTATTTATTCAGATTTATTGCAGTTTTTACTTATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023568 Nonsense 337 895 7 18
ENSDART00000134521   None 182 None 4
Genomic Location (Zv9):
Chromosome 7 (position 33337869)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31732209
GRCz11 7 32003359
KASP Assay ID:
554-3724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGCCGAACTGTAATGATTGCAAATGTCAGTCCATCCTCACTTTCATA[T/A]GAAGATACACACAACACTCTCAAATATGCCAACCGCGCCAAGGAGATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023568 Nonsense 490 895 11 18
ENSDART00000134521   None 182 None 4
Genomic Location (Zv9):
Chromosome 7 (position 33330458)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31724798
GRCz11 7 31995948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGAGCGCAAACTGGCCTCCCTAAAGTCTCACCAGGAGCACTTGCAA[C/T]AACGCTTAATGGAGAGTGAAAAGTGCTTCCAGGAGAACGAGGGATGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link