
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mxg
- Ensembl ID:
- ENSDARG00000008019
- ZFIN ID:
- ZDB-GENE-030721-10
- Description:
- myxovirus (influenza virus) resistance G [Source:RefSeq peptide;Acc:NP_001116443]
- Human Orthologues:
- AC019294.4, MX1, MX2
- Human Descriptions:
- myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
- myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
- Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
- Mouse Orthologues:
- Mx1, Mx2
- Mouse Descriptions:
- myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
- myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24663 | Essential Splice Site | Available for shipment | Available now |
sa24664 | Nonsense | Available for shipment | Available now |
sa7260 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24663
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104340 | Essential Splice Site | 241 | 628 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20193854)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19605831 GRCz11 25 19703782 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATTAAAACTTGCACAAGAAGTAGATCCTGAGGGCAAAAGAACTATTGG[T/A]AATGTAATACAGAACACCTGTATATAAACACACACGCAAACATTAAATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24664
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104340 | Nonsense | 369 | 628 | 8 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20198079)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19610056 GRCz11 25 19708007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGATCTAAAAGAGTGTGAGTCTGGACCCCCACAGGATTCAAAAGGGGCC[A/T]AACAATTTCTTATTAAAGTAAGAAGTTTTAATTATCCCATCTAGCAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7260
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104340 | Nonsense | 421 | 628 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20200680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19612657 GRCz11 25 19710608 - KASP Assay ID:
- 554-4931.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGTATTSTCTTTTAATAAGAAATGCATATTGTTCTCCAACAAGTAAAA[C/T]AATCAACTAAAGAGAAAATAGAGGTTCTCCAGAATTTCAGAGGGAGAGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: