zgc:101026

Ensembl ID:
ENSDARG00000007971
ZFIN ID:
ZDB-GENE-040801-112
Description:
CDC28 protein kinase 1B [Source:RefSeq peptide;Acc:NP_001003593]
Human Orthologue:
CKS1B
Human Description:
CDC28 protein kinase regulatory subunit 1B [Source:HGNC Symbol;Acc:19083]
Mouse Orthologues:
Cks1b, Gm6531
Mouse Descriptions:
CDC28 protein kinase 1b Gene [Source:MGI Symbol;Acc:MGI:1889208]
predicted gene 6531 Gene [Source:MGI Symbol;Acc:MGI:3643620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43220 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026276 Nonsense 71 79 4 4
Genomic Location (Zv9):
Chromosome 19 (position 8460240)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7918779
GRCz11 19 7837704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTGATTTTCTTTTTCTTTATAGAACCACACATCTTGCTCTTCCGA[C/T]GACCTCTGCCTGTGGCACAATCCCACTGATCTCAAAACCACCCTAAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link