iars

Ensembl ID:
ENSDARG00000007955
ZFIN ID:
ZDB-GENE-030131-6325
Description:
isoleucyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_956190]
Human Orthologue:
IARS
Human Description:
isoleucyl-tRNA synthetase [Source:HGNC Symbol;Acc:5330]
Mouse Orthologue:
Iars
Mouse Description:
isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27708 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21826 Nonsense Available for shipment Available now
sa41755 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004423 Essential Splice Site None 1270 1 35
Genomic Location (Zv9):
Chromosome 11 (position 1357459)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1365832
GRCz11 11 1392420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTTGCATCATTTCCGCTGTCTCTGTTCACCGGCGACGGCCAGCATG[T/C]GAGTGTGATCTGACACTTCATCTTAATATAAAACTTTCTCAAACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004423 Nonsense 409 1270 13 35
Genomic Location (Zv9):
Chromosome 11 (position 1335417)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1343790
GRCz11 11 1370378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATATTGAACAACTCGTTGGTTTGCAGGTCGGACACGCCGCTGATCTA[C/A]AAAGCAGTGCCCAGCTGGTTTATAAGGGTGGAGCACATGGTGGAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004423 Essential Splice Site 1143 1270 32 35
Genomic Location (Zv9):
Chromosome 11 (position 1306398)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1314771
GRCz11 11 1341359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTCGGCCTCAACGGAGCTCCAGTCTCCATATTCAACGGCAAGACAG[G/A]TGAGAGCTCCAAATATAACAGTGGAGCCTGTTCACATGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link