
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ehd3
- Ensembl ID:
- ENSDARG00000007869
- ZFIN ID:
- ZDB-GENE-041014-352
- Description:
- EH domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001038469]
- Human Orthologue:
- EHD3
- Human Description:
- EH-domain containing 3 [Source:HGNC Symbol;Acc:3244]
- Mouse Orthologue:
- Ehd3
- Mouse Description:
- EH-domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1928900]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6644 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6645 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6644
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022694 | Nonsense | 208 | 535 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38257178)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38329590 GRCz11 20 38232469 - KASP Assay ID:
- 554-4089.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCCACAAGCTGGACATCTCAGATGAGTTTTCAGAGGTCATCAAGGCCCTA[A/T]AGAACCATGAAGACAAGATCCGTGTGGTGCTCAACAAGGCCGACCAGATY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6645
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022694 | Nonsense | 448 | 535 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 38265751)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 38338163 GRCz11 20 38241042 - KASP Assay ID:
- 554-5444.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGGGCATTGATGAAGTAGAATGGGTTGTGGCACGTGACAAACCCATGTA[T/A]GATGAAATCTTCTACACTCTCTCGCCTGTCAATGGCAAAGTGACTGGGGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
- Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: