atf3

Ensembl ID:
ENSDARG00000007823
ZFIN ID:
ZDB-GENE-040426-728
Description:
cyclic AMP-dependent transcription factor ATF-3 [Source:RefSeq peptide;Acc:NP_957258]
Human Orthologue:
ATF3
Human Description:
activating transcription factor 3 [Source:HGNC Symbol;Acc:785]
Mouse Orthologue:
Atf3
Mouse Description:
activating transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:109384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43503 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022060 Nonsense 145 202 4 4
ENSDART00000121561 Nonsense 149 206 6 6
Genomic Location (Zv9):
Chromosome 20 (position 37823223)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37895736
GRCz11 20 37798615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAAGCTCAGATCGAGGAGCTGAAGAACCAAAAGCAGCAGCTTGTTTA[C/A]ATGCTCAACCTGCACAGGCCCACCTGCATCGTCCGCGCTCAGAACGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link