zdhhc16

Ensembl ID:
ENSDARG00000007808
ZFIN ID:
ZDB-GENE-040426-1621
Description:
probable palmitoyltransferase ZDHHC16 [Source:RefSeq peptide;Acc:NP_957336]
Human Orthologue:
ZDHHC16
Human Description:
zinc finger, DHHC-type containing 16 [Source:HGNC Symbol;Acc:20714]
Mouse Orthologue:
Zdhhc16
Mouse Description:
zinc finger, DHHC domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1921418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42232 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019427 Nonsense 36 387 2 12
ENSDART00000098860 Nonsense 36 387 1 10
ENSDART00000134630 Nonsense 36 387 2 11
Genomic Location (Zv9):
Chromosome 13 (position 31611552)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31257500
GRCz11 13 31387950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACACTCGAAGTCGCGTGCCCAGAAGACTGAGGAGACATGTCAGCTA[T/A]ATCAGACTCATCTTCAAGTCCCTTTATTTTAACTCGCTCACTAACTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link