
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gas6
- Ensembl ID:
- ENSDARG00000007804
- ZFIN ID:
- ZDB-GENE-030131-7773
- Description:
- growth arrest-specific protein 6 [Source:RefSeq peptide;Acc:NP_956272]
- Human Orthologue:
- GAS6
- Human Description:
- growth arrest-specific 6 [Source:HGNC Symbol;Acc:4168]
- Mouse Orthologue:
- Gas6
- Mouse Description:
- growth arrest specific 6 Gene [Source:MGI Symbol;Acc:MGI:95660]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9012 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19391 | Nonsense | Available for shipment | Available now |
sa32572 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9012
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010092 | Essential Splice Site | 267 | 648 | 8 | 15 |
- Genomic Location (Zv9):
- Chromosome 1 (position 198141)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 328271 GRCz11 1 323450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGACGGTCGTCTGGGAAAGAGACTGAGCTCAGACATGAGGAGCTGTGAGG[T/C]GAACRACACACAATACTAGCAGATTATAGGAAAAAGTCAAASYAAATTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19391
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010092 | Nonsense | 368 | 648 | 10 | 15 |
- Genomic Location (Zv9):
- Chromosome 1 (position 195558)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 325688 GRCz11 1 320867 - KASP Assay ID:
- 2259-0014.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCGTGAGTCGAGTGACCAGCAGCGGACCGCAGGTCAACGACGGGCAGT[G/A]GCACAAGGTGAGAGGTCAGAGGTCACGAAAAAATGCTGCTCTTATTTAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32572
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010092 | Essential Splice Site | 598 | 648 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 1 (position 190709)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 320839 GRCz11 1 316018 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCTGGATCTCACATCCTCATACAGCACCTTCATAGGGGGCATCCCAG[G/A]TAATGTCTCACATTGGTCTGGTATGGTCTCACATCCACCTCGCAATAGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: