WDR61

Ensembl ID:
ENSDARG00000007755
Description:
WD repeat domain 61 [Source:HGNC Symbol;Acc:30300]
Human Orthologue:
WDR61
Human Description:
WD repeat domain 61 [Source:HGNC Symbol;Acc:30300]
Mouse Orthologue:
Wdr61
Mouse Description:
WD repeat domain 61 Gene [Source:MGI Symbol;Acc:MGI:1917493]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32511 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037044 Essential Splice Site 49 303 3 9
ENSDART00000130809 Essential Splice Site 49 305 3 13
Genomic Location (Zv9):
Chromosome 25 (position 6644699)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6164141
GRCz11 25 6291543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCATTGTGACCGGCTCTCTGGATGACCTGGTCAAAGTGTGGAAATG[G/A]TAAATCAATGAGCAAAGTGCAGTAAAAGGGTAAACTTTTGATTTAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link