zgc:64174

Ensembl ID:
ENSDARG00000007734
ZFIN ID:
ZDB-GENE-040426-1390
Description:
CST complex subunit STN1 [Source:UniProtKB/Swiss-Prot;Acc:B8JKF4]
Human Orthologue:
OBFC1
Human Description:
oligonucleotide/oligosaccharide-binding fold containing 1 [Source:HGNC Symbol;Acc:26200]
Mouse Orthologue:
Obfc1
Mouse Description:
oligonucleotide/oligosaccharide-binding fold containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915581]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19569 Essential Splice Site Available for shipment Available now
sa15644 Nonsense Available for shipment Available now
sa19570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027624 Essential Splice Site 77 368 2 9
Genomic Location (Zv9):
Chromosome 1 (position 48000806)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46812467
GRCz11 1 47503699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGATTGTTGTTTACAAGCGGGAGAGAGAGGATTTCTACTGCTATGGAG[G/A]TCTGTGTTAAAGTGAAAGTAAAAAGTAAAAAAAGTGGACACATTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027624 Nonsense 296 368 8 9
Genomic Location (Zv9):
Chromosome 1 (position 48008252)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46819913
GRCz11 1 47511145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAAAATGTAATTACATTTTTATAATCWTCRCTGCTTTAGGTAACAGAA[C/T]AAGACAAAGATCTTCATATAGCGATCAAGGATGTTTTACRAGAGGATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027624 Nonsense 308 368 8 9
Genomic Location (Zv9):
Chromosome 1 (position 48008289)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46819950
GRCz11 1 47511182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGTAACAGAACAAGACAAAGATCTTCATATAGCGATCAAGGATGTTT[T/A]ACGAGAGGATACCAAACGGGAAAAATGTGAGTTGTACATCTATTTATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Exercise treadmill test traits: Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study. (View Study)
  • Telomere length: Genome-wide association identifies OBFC1 as a locus involved in human leukocyte telomere biology. (View Study)
  • Telomere length: Genome-wide meta-analysis points to CTC1 and ZNF676 as genes regulating telomere homeostasis in humans. (View Study)
  • Telomere length: Identification of seven loci affecting mean telomere length and their association with disease. (View Study)
  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link