zgc:123242

Ensembl ID:
ENSDARG00000007678
ZFIN ID:
ZDB-GENE-051120-105
Description:
Protein tweety homolog 3 [Source:UniProtKB/Swiss-Prot;Acc:Q32LT7]
Human Orthologue:
TTYH3
Human Description:
tweety homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:22222]
Mouse Orthologue:
Ttyh3
Mouse Description:
tweety homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925589]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39564 Nonsense Mutation detected in F1 DNA During 2018
sa11740 Nonsense Available for shipment Available now
sa32613 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033361 Nonsense 160 560 5 15
ENSDART00000131116 Nonsense 163 563 4 14
Genomic Location (Zv9):
Chromosome 1 (position 10990293)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11122370
GRCz11 1 11809170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAATGAAACCCTGATGGAGGGTTTGGTGCAACTGGAGACCGTGTACT[C/A]GAAGCAGACAGACTACCTGTCCATCGTCCAGAAACTGCAGGGCCAGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033361 Nonsense 391 560 12 15
ENSDART00000131116 Nonsense 394 563 11 14
Genomic Location (Zv9):
Chromosome 1 (position 10975855)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11107932
GRCz11 1 11794732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAGGCTCTGACCGGACTGTGTTATGATGGAGTMGAGGGTCTCATTTA[T/G]CTGGTCYTGTTCTCATTCGTYACCGCGCTAATGTTTAGCTCCATCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033361 Nonsense 476 560 13 15
ENSDART00000131116 Nonsense 479 563 12 14
Genomic Location (Zv9):
Chromosome 1 (position 10971475)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11103552
GRCz11 1 11790352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTAGTCTCCCCGCTGCGGCACACACTGTCAGCAACGCACCAGTCACT[G/T]AGTACATGTGAGTGTAGCCACGCTAACCTCATCCTAATGCATGGGCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link