zgc:63566

Ensembl ID:
ENSDARG00000007639
ZFIN ID:
ZDB-GENE-040426-1164
Description:
hypothetical protein LOC394144 [Source:RefSeq peptide;Acc:NP_957463]
Human Orthologue:
CNOT4
Human Description:
CCR4-NOT transcription complex, subunit 4 [Source:HGNC Symbol;Acc:7880]
Mouse Orthologue:
Cnot4
Mouse Description:
CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33419 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022646 Nonsense 238 798 7 13

The following transcripts of ENSDARG00000007639 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11334513)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12271140
GRCz11 4 12269989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACTCTTAGTGTTTGACTTTGCAGGCAGGGAAACATCAGGAATATGAA[C/T]AGAAACTCTTACAGGAACTCTACAAAACAAATCCCAACTTCCTACAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link