wwox

Ensembl ID:
ENSDARG00000007614
ZFIN ID:
ZDB-GENE-040426-858
Description:
WW domain-containing oxidoreductase [Source:UniProtKB/Swiss-Prot;Acc:Q803A8]
Human Orthologue:
WWOX
Human Description:
WW domain containing oxidoreductase [Source:HGNC Symbol;Acc:12799]
Mouse Orthologue:
Wwox
Mouse Description:
WW domain-containing oxidoreductase Gene [Source:MGI Symbol;Acc:MGI:1931237]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9191 Nonsense Mutation detected in F1 DNA During 2018
sa44361 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38145 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020806 Nonsense 85 384 4 10
Genomic Location (Zv9):
Chromosome 25 (position 38094583)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36496372
GRCz11 25 37067261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTMTYTTTCCCTCTTGTCCTCAGTCACATCAACAAGCGTAAGAYGTA[T/A]TTCGACCCTCGGCAGGCCTTCACTGTAGAGGACATGCAGGTGAAGCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020806 Essential Splice Site 199 384 6 10
Genomic Location (Zv9):
Chromosome 25 (position 38016114)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36417989
GRCz11 25 36988878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGAGGAGCGTCCGACAGTTCGCAGAGCTCTTCAAAGCCACAAAACT[G/A]TGAGTAAAACACTGCCGAAATAAAGCAGATCCATCAGAGACTCAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020806 Essential Splice Site 261 384 7 10
Genomic Location (Zv9):
Chromosome 25 (position 38002396)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36404271
GRCz11 25 36975160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTCTCGGCTCCGGCACGGGTCGTGGTGGTTTCCTCCGAGTCCCACAG[G/A]TCAGCATTTCACATCATTCCTGCAGACGTATGCAGATATTCAGTAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020806 Nonsense 292 384 8 10
Genomic Location (Zv9):
Chromosome 25 (position 37994140)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36396015
GRCz11 25 36966904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGCTGTCTCCTCCACAGAAGAACTACTGGTCTCTGCTGGCCTACAAC[C/T]GAGCCAAACTCTGCAACCTGCTGTTCTCCAGCGAGCTGCACCGCCGCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link